• ¿Quieres apoyar a nuestro foro haciendo una donación?, entra aquí.

Risas compulsivas: los mejores chistes para empezar el año

john bic

Animal
Registrado
2017/07/20
Mensajes
2.177
Sexo
Macho
Primer chiste:

¿Cuál es el juguete más egocéntrico que existe?

El yoyo.
JAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJJAJAJAAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJA

Segundo chiste:

Un soldado se dirige a la base donde estaba el coronel a cargo y le dice:

- Señor, vengo a entregarle el reporte del estado de nuestra unidad en el último combate. No hay ningún herido.

El coronel exclama:

- ¡Qué bién!. ¡Así me gusta!

Y soldado dice:

Todos muertos
JAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJJAJAJAAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJAJA

Tercer chiste:

¿En qué se parece un bebé chileno a un perro que se ríe?

En que a los bebés chilenos les dicen guagua, y los perros se ríen así: GUAGUAGUAGUAGUAGUAGUAGUAGUAGUAGUAGUAGUAGUAGUAGUA









 
Arriba